Learn More
Invitrogen™ T7 Promoter Primer
Thermo Fisher Scientific offers primers for PCR amplification that complement many of the vectors currently available.
Brand: Invitrogen™ N56002
232.01 EUR valid until 2024-03-29
Use promo code "21615" to get your promotional price.
Additional Details : Weight : 0.01000kg
Description
Thermo Fisher Scientific offers primers for PCR amplification that complement many of the vectors currently available. The T7 Promoter Primer is recognized by T7 RNA polymerase and is commonly used to regulate gene expression of recombinant proteins. Subsequent recombinant proteins may be used for further downstream research applications.
T7 Promoter Primer features include:
• Desalted and purified by gel filtration
• Assayed for function by PCR amplification
• Provided in 2 μg quantity
Applications
• Sanger sequencing
• PCR amplification
T7 Primer Sequence: 5´- TAATACGACTCACTATAGGG- 3´
Order Info
Shipping Conditions: Room Temperature
Specifications
T7 | |
• T7 Promoter Primer (2 μg) Store in Freezer at –20°C. Guaranteed stable for 6 months when properly stored. |
|
5 ́d[TAATACGACTCACTATAGGG]3 ́ | |
Room Temperature | |
2 μg | |
Lyophilized |
Primer | |
20-mer | |
Gel-purified | |
T7 | |
PCR Amplification |
For Research Use Only. Not for use in diagnostic procedures.